Back Home
Back Home
Molecular Modeling and Bioinformatics Group

BIGNASim database structure and analysis portal for nucleic acids simulation data


Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_ProtDNA_1a66 1A66 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CAATTTTCCTCG
NAFlex_ProtDNA_1c7u 1C7U Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTCGGCTATTAATAGCCGAG
NAFlex_ProtDNA_1cdw 1CDW Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTGCTATAAAAGGCTG
NAFlex_ProtDNA_1h9t 1H9T Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CATCTGGTACGACCAGATC
NAFlex_ProtDNA_1hlv 1HLV Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AATCCCGTTTCCAACGAAGGC
NAFlex_ProtDNA_1iv6 1IV6 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCCTAACCCTAAC
NAFlex_ProtDNA_1j46 1J46 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCTGCACAAACACC
NAFlex_ProtDNA_1j5n 1J5N Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTGAACAATCACCCC
NAFlex_ProtDNA_1je8 1JE8 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTACCCATTAATGGGTACG
NAFlex_ProtDNA_1k6o 1K6O Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CACAGGATGTCCATATTAGGACA
NAFlex_ProtDNA_1qn5 1QN5 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 TGCCCTCTTATAGC
NAFlex_ProtDNA_1r4i 1R4I Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCAGAACATCAAGAACAG
NAFlex_ProtDNA_1vtn 1VTN Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GACTAAGTCAACC
NAFlex_ProtDNA_1yo5 1YO5 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 ACACATCCTGCTA
NAFlex_ProtDNA_1zgw 1ZGW Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GCAAATTAAAGCGCAAGA
NAFlex_ProtDNA_2hdc 2HDC Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GCTTAAAATAACAATAC
NAFlex_ProtDNA_2kdz 2KDZ Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AAGATAACGATATTTA
NAFlex_ProtDNA_2l1g 2L1G Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGCTGCCCACACAAGC
NAFlex_ProtDNA_2lt7 2LT7 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTTATTGGCAGGAAGCAC
NAFlex_ProtDNA_2or1 2OR1 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AAGTACAAACTTTCTTGTAT
NAFlex_ProtDNA_2stw 2STW Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 TCGAACTTCCGGCTCGA
NAFlex_ProtDNA_3f27 3F27 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCAGGACAATAGAGAC
NAFlex_ProtDNA_3jxc 3JXC Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CATTTAAGATATCTTAAATG
NAFlex_ProtDNA_3u2b 3U2B Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GTCTCTATTGTCCTGG
NAFlex_ProtDNA_4f6n 4F6N Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTATAGACGCGGTGACAC
NAFlex_ProtDNA_4hqe 4HQE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AGTATAATTATTATACC
NAFlex_ProtDNA_4oi7 4OI7 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CACGTTCGTAGCATCGTTGCAG
NAFlex_ProtDNA_s1j5n 1J5N Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GGGGTGATTGTTCAG
NAFlex_ProtDNA_s2lef 2LEF Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CACCCTTTGAAGCTC
NAFlex_ProtDNA_1a0a 1A0A Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTAGTCCCACGTGTGAG
NAFlex_1p71 1P71 Prot-Dna B parmBSC1 SPCE DNA-B Duplex Complex ParmBSC1 SPC/E AddedSalt Protein-nuc Flipout-bases 1,000 TGCTTATCAATTTGTTGCA
NAFlex_muAAAA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCAAAAAAAAAAAAAAGC
NAFlex_muAAAC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCACAAACAAACAAACGC
NAFlex_muAAAT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCATAAATAAATAAATGC
NAFlex_muAGAG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCAGAGAGAGAGAGAGGC
NAFlex_muAGCT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCCTAGCTAGCTAGCTGC
NAFlex_muAGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGAAGGAAGGAAGGAGC
NAFlex_muAGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCAGGCAGGCAGGCGC
NAFlex_muAGGT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGTAGGTAGGTAGGTGC
NAFlex_muAGTC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTCAGTCAGTCAGTCGC
NAFlex_muAGTG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTGAGTGAGTGAGTGGC
NAFlex_muATGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCATGCATGCATGCGC
NAFlex_muCAAG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCAGCAAGCAAGCAAGGC
NAFlex_muCAAT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCATCAATCAATCAATGC
NAFlex_muCGCG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCCGCGCGCGCGCGCGGC
NAFlex_muCGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGACGGACGGACGGAGC
NAFlex_muCGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCCGGCCGGCCGGCGC
NAFlex_muCGGT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGTCGGTCGGTCGGTGC
NAFlex_muCGTA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTACGTACGTACGTAGC
NAFlex_muCGTG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTGCGTGCGTGCGTGGC
NAFlex_muGAAA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCAAGAAAGAAAGAAAGC
NAFlex_muGAAC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCACGAACGAACGAACGC
NAFlex_muGAAT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCATGAATGAATGAATGC
NAFlex_muGATA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTAGATAGATAGATAGC
NAFlex_muGGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGAGGGAGGGAGGGAGC
NAFlex_muGGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCGGGCGGGCGGGCGC
NAFlex_muGGGG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGGGGGGGGGGGGGGGC
NAFlex_muGGGT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGTGGGTGGGTGGGTGC
NAFlex_muTAAC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCACTAACTAACTAACGC
NAFlex_muTAAG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCAGTAAGTAAGTAAGGC
NAFlex_muTAAT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCATTAATTAATTAATGC
NAFlex_muTATA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTATATATATATATAGC
NAFlex_muTCGA NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCGATCGATCGATCGAGC
NAFlex_muTGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGATGGATGGATGGAGC
NAFlex_muTGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCTGGCTGGCTGGCGC
NAFlex_muTGGT NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGTTGGTTGGTTGGTGC
NAFlex_muTGTA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTATGTATGTATGTAGC
NAFlex_muTGTC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTCTGTCTGTCTGTCGC
NAFlex_muTGTG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTGTGTGTGTGTGTGGC
NAFlex_miniABC_K_1 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAACGTGCTATGGAAGC
NAFlex_miniABC_K_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_K_9 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGTTAGATTAAAATTGC
NAFlex_miniABC_Na_2 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAATAAGTACCAGGAGC
NAFlex_miniABC_Na_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_NaK_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_NaK_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_K_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_K_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_Na_1 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAACGTGCTATGGAAGC
NAFlex_miniABC_Na_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_Na_9 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGTTAGATTAAAATTGC
NAFlex_miniABC_NaK_2 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAATAAGTACCAGGAGC
NAFlex_miniABC_NaK_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_K_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_K_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_Na_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_Na_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_NaK_1 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAACGTGCTATGGAAGC
NAFlex_miniABC_NaK_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_NaK_9 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGTTAGATTAAAATTGC
NAFlex_miniABC_K_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_K_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGAACTCAAAGGTTGGC
NAFlex_miniABC_Na_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_Na_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_NaK_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_NaK_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_K_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_K_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_Na_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_Na_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGAACTCAAAGGTTGGC
NAFlex_miniABC_NaK_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_NaK_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_K_2 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAATAAGTACCAGGAGC
NAFlex_miniABC_K_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_Na_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_Na_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_NaK_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_NaK_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGAACTCAAAGGTTGGC
NAFlex_FOXO3_crystal_rep0 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 500 GACTATGTAAACAACGC
NAFlex_colibactin1 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 400 CGCGAAAATTTTCGCG
NAFlex_FOXA3_crystal_rep0 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep1 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep2 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep3 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep4 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep5 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_mut_rep0 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep1 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep2 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep3 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep4 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep5 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_mut_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_crystal_rep1 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep2 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep3 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep4 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep5 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_dna_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_MuG_TRF1 1W0T Dna B parmBSC0 SPCE DNA-B Duplex Complex ParmBSC0 SPC/E 40 TGTTAGGGTTAGGGTTAG